View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0331-INSERTION-7 (Length: 85)
Name: NF0331-INSERTION-7
Description: NF0331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0331-INSERTION-7 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 6e-37; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 6e-37
Query Start/End: Original strand, 8 - 85
Target Start/End: Complemental strand, 32523286 - 32523209
Alignment:
| Q |
8 |
gactcttctctcagtttcctaaatacaacggtactgttcacgccattttcaccattgctcgcaccgaggtttgtgttc |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32523286 |
gactcttctctcagtttcctaaatacaacggtactgttcacgccattttcaccattgctcgcaccgaggtttgtgttc |
32523209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University