View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0331_high_2 (Length: 335)

Name: NF0331_high_2
Description: NF0331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0331_high_2
NF0331_high_2
[»] chr5 (2 HSPs)
chr5 (1-149)||(12514601-12514749)
chr5 (227-322)||(12514832-12514927)


Alignment Details
Target: chr5 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 1 - 149
Target Start/End: Original strand, 12514601 - 12514749
Alignment:
1 tattatgactcatccaccaccacctcctacccccactcccatacttatcttccccatgttagtctcttcaattcaatcacaatcataatcacaacttacc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12514601 tattatgactcatccaccaccacctcctacccccactcccatacttatcttccccatgttagtctcttcaattcaatcacaatcataatcacaacttacc 12514700  T
101 cacctctttcttttcttcacttttctctctttgcaaagtacattgcaaa 149  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||    
12514701 cacctctttcttttcttcactgttctctctttgcaaagtacattgcaaa 12514749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 227 - 322
Target Start/End: Original strand, 12514832 - 12514927
Alignment:
227 agtcaaatggaatctaaagaaggtgatgagagnnnnnnngaacacaaagtttctatgttaaagctattttcttttgctgactcttatgatgatgtc 322  Q
    |||||||||||||| |||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
12514832 agtcaaatggaatccaaagaaggtgatgagagaaaaaaagaacacaaagtttctatgttaaagctattttcttttgctgactcttatgattatgtc 12514927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University