View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0331_high_2 (Length: 335)
Name: NF0331_high_2
Description: NF0331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0331_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 1 - 149
Target Start/End: Original strand, 12514601 - 12514749
Alignment:
Q |
1 |
tattatgactcatccaccaccacctcctacccccactcccatacttatcttccccatgttagtctcttcaattcaatcacaatcataatcacaacttacc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12514601 |
tattatgactcatccaccaccacctcctacccccactcccatacttatcttccccatgttagtctcttcaattcaatcacaatcataatcacaacttacc |
12514700 |
T |
 |
Q |
101 |
cacctctttcttttcttcacttttctctctttgcaaagtacattgcaaa |
149 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
12514701 |
cacctctttcttttcttcactgttctctctttgcaaagtacattgcaaa |
12514749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 227 - 322
Target Start/End: Original strand, 12514832 - 12514927
Alignment:
Q |
227 |
agtcaaatggaatctaaagaaggtgatgagagnnnnnnngaacacaaagtttctatgttaaagctattttcttttgctgactcttatgatgatgtc |
322 |
Q |
|
|
|||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
12514832 |
agtcaaatggaatccaaagaaggtgatgagagaaaaaaagaacacaaagtttctatgttaaagctattttcttttgctgactcttatgattatgtc |
12514927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University