View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0331_high_5 (Length: 252)
Name: NF0331_high_5
Description: NF0331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0331_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 53 - 224
Target Start/End: Original strand, 37709450 - 37709621
Alignment:
Q |
53 |
gtgaccatatagttttattaattatattgtgtcaataatctttatcttcaatctatctttcctcaagatgttggtgaatgttaagaattttttgttaata |
152 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
37709450 |
gtgaccatatagttttattaattatattgtgtcaataatctttatcttcaatctatctttcctcaagatgttagtgaatgttaagaattttttgttaata |
37709549 |
T |
 |
Q |
153 |
ttaagaggtgggactaaagagggaagaaaatcacttggttgaagtgagatgatgcgtagaagtgaaggaagt |
224 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
37709550 |
ttaagaggtgggactaaagagggaagaaaatcacttggttgaagtgagatgatgcgtagaagtgagggaagt |
37709621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1998 times since January 2019
Visitors: 2877