View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0331_high_6 (Length: 246)
Name: NF0331_high_6
Description: NF0331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0331_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 26 - 154
Target Start/End: Original strand, 22235699 - 22235827
Alignment:
Q |
26 |
gaaggaagagttcaaatatacattatttgtgtttttacacttcccttttgagcaactgcaaatacttggattgttttcgctattcagttggcagggatgc |
125 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22235699 |
gaaggaagagttcaaatatacattatttgtgtttttacacttcccttttgagcaacttcaaatacttggattgttttcgctattcagttggcagggatgc |
22235798 |
T |
 |
Q |
126 |
atatggaaggaaaagaagttgaggaatta |
154 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
22235799 |
atatggaaggaaaagaagttgaggaatta |
22235827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2073 times since January 2019
Visitors: 2894