View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0331_high_6 (Length: 246)

Name: NF0331_high_6
Description: NF0331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0331_high_6
NF0331_high_6
[»] chr4 (1 HSPs)
chr4 (26-154)||(22235699-22235827)


Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 26 - 154
Target Start/End: Original strand, 22235699 - 22235827
Alignment:
26 gaaggaagagttcaaatatacattatttgtgtttttacacttcccttttgagcaactgcaaatacttggattgttttcgctattcagttggcagggatgc 125  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
22235699 gaaggaagagttcaaatatacattatttgtgtttttacacttcccttttgagcaacttcaaatacttggattgttttcgctattcagttggcagggatgc 22235798  T
126 atatggaaggaaaagaagttgaggaatta 154  Q
    |||||||||||||||||||||||||||||    
22235799 atatggaaggaaaagaagttgaggaatta 22235827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University