View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0331_low_1 (Length: 410)
Name: NF0331_low_1
Description: NF0331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0331_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 2e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 132 - 288
Target Start/End: Complemental strand, 1109169 - 1109017
Alignment:
| Q |
132 |
aatatatgctttcttcttcacatccttatacgtatttctctgcacatgatctgtagcatctgcaggaaggggttccatgccattattgatctcaatctgt |
231 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1109169 |
aatatatgctttcttcttcacatcgttatacatatttctctg-ac---atctgtagcatctgcaggaaggggttccatgccattattgatctcaatctgt |
1109074 |
T |
|
| Q |
232 |
tcagacacattgtgaactgcaaagatcacattcatatgtctgaaccatcgttcacag |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1109073 |
tcagacacattgtgaactgcaaagatcacattcatatgtctgaaccatcgttcacag |
1109017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1988 times since January 2019
Visitors: 2876