View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0331_low_2 (Length: 349)
Name: NF0331_low_2
Description: NF0331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0331_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 104 - 206
Target Start/End: Complemental strand, 1306863 - 1306762
Alignment:
Q |
104 |
gaggaggagcagagaggaggtgccaggattggtcttcgaggagtggagttggatcgtcgagttgcggtggtggttccggcggagacattttggatcggcg |
203 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1306863 |
gaggaggag-agagaggaggtgccaggattggtcttcgaggagtggagttggatcgtcgagttgcggtggtggttccggcggagacattttggatcggcg |
1306765 |
T |
 |
Q |
204 |
gtt |
206 |
Q |
|
|
||| |
|
|
T |
1306764 |
gtt |
1306762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University