View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0331_low_4 (Length: 328)

Name: NF0331_low_4
Description: NF0331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0331_low_4
NF0331_low_4
[»] chr8 (1 HSPs)
chr8 (268-308)||(33548912-33548952)
[»] chr3 (1 HSPs)
chr3 (132-173)||(1109128-1109169)


Alignment Details
Target: chr8 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 268 - 308
Target Start/End: Complemental strand, 33548952 - 33548912
Alignment:
268 cttcattcattcaatttaataaataatacatcggacaacac 308  Q
    |||||||||||||||||||||||||||||||||||||||||    
33548952 cttcattcattcaatttaataaataatacatcggacaacac 33548912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 132 - 173
Target Start/End: Complemental strand, 1109169 - 1109128
Alignment:
132 aatatatgctttcttcttcacatccttatacgtatttctctg 173  Q
    |||||||||||||||||||||||| |||||| ||||||||||    
1109169 aatatatgctttcttcttcacatcgttatacatatttctctg 1109128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University