View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0331_low_4 (Length: 328)
Name: NF0331_low_4
Description: NF0331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0331_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 268 - 308
Target Start/End: Complemental strand, 33548952 - 33548912
Alignment:
Q |
268 |
cttcattcattcaatttaataaataatacatcggacaacac |
308 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33548952 |
cttcattcattcaatttaataaataatacatcggacaacac |
33548912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 132 - 173
Target Start/End: Complemental strand, 1109169 - 1109128
Alignment:
Q |
132 |
aatatatgctttcttcttcacatccttatacgtatttctctg |
173 |
Q |
|
|
|||||||||||||||||||||||| |||||| |||||||||| |
|
|
T |
1109169 |
aatatatgctttcttcttcacatcgttatacatatttctctg |
1109128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1987 times since January 2019
Visitors: 2876