View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0331_low_5 (Length: 303)
Name: NF0331_low_5
Description: NF0331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0331_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 45 - 245
Target Start/End: Complemental strand, 43953796 - 43953596
Alignment:
Q |
45 |
tgaagtctacgaggcagctctcgaagcacaaggaatctcacatcttatgtcttctgaagttgtcaaggcatttttggattctaacaaactctctagaggt |
144 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43953796 |
tgaagtctacgaggcagctctcgaagcacaaggaatctcacatcttatgtcttctgaagttgtcaaggcatttttggattctaacaaactctctagaggt |
43953697 |
T |
 |
Q |
145 |
tagatcgagataaggcatttcagcaccattgaaaaatgcttttgtatttaatctgtttttctgttaaactttagaaaataccttatatgatgattttatt |
244 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43953696 |
tagatcgagataaggcatttcagcaccattgaaaaatgcttttgtatttaatctgtttttctgttaaactttagaaaataccttatatgatgattttatt |
43953597 |
T |
 |
Q |
245 |
a |
245 |
Q |
|
|
| |
|
|
T |
43953596 |
a |
43953596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University