View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0331_low_5 (Length: 303)

Name: NF0331_low_5
Description: NF0331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0331_low_5
NF0331_low_5
[»] chr4 (1 HSPs)
chr4 (45-245)||(43953596-43953796)


Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 45 - 245
Target Start/End: Complemental strand, 43953796 - 43953596
Alignment:
45 tgaagtctacgaggcagctctcgaagcacaaggaatctcacatcttatgtcttctgaagttgtcaaggcatttttggattctaacaaactctctagaggt 144  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43953796 tgaagtctacgaggcagctctcgaagcacaaggaatctcacatcttatgtcttctgaagttgtcaaggcatttttggattctaacaaactctctagaggt 43953697  T
145 tagatcgagataaggcatttcagcaccattgaaaaatgcttttgtatttaatctgtttttctgttaaactttagaaaataccttatatgatgattttatt 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43953696 tagatcgagataaggcatttcagcaccattgaaaaatgcttttgtatttaatctgtttttctgttaaactttagaaaataccttatatgatgattttatt 43953597  T
245 a 245  Q
    |    
43953596 a 43953596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University