View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0333_low_17 (Length: 206)
Name: NF0333_low_17
Description: NF0333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0333_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 4e-83; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 25 - 184
Target Start/End: Complemental strand, 12740533 - 12740374
Alignment:
| Q |
25 |
agcagagacaatggcagtgaaacattctgcaaatgtggtgaagggtggagttgttccattttcaaaactgaaggccctggtgtaaactctggcaagggct |
124 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12740533 |
agcagtgacaatggcagtgaaacattctgcaaatgtggtgaagggtggagttgttccattttcaaaactgaaggccctggtgtaaactctggcaagggct |
12740434 |
T |
 |
| Q |
125 |
ttgctgaatgcactcaacagtataactgtgcttgtaactgttgattctgatagaccaatt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12740433 |
ttgctgaatgcactcaacagtataactgtgcttgtaactgttgattctgatagaccaatt |
12740374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 25 - 184
Target Start/End: Complemental strand, 12803357 - 12803198
Alignment:
| Q |
25 |
agcagagacaatggcagtgaaacattctgcaaatgtggtgaagggtggagttgttccattttcaaaactgaaggccctggtgtaaactctggcaagggct |
124 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12803357 |
agcagtgacaatggcagtgaaacattctgcaaatgtggtgaagggtggagttgttccattttcaaaactgaaggccctggtgtaaactctggcaagggct |
12803258 |
T |
 |
| Q |
125 |
ttgctgaatgcactcaacagtataactgtgcttgtaactgttgattctgatagaccaatt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12803257 |
ttgctgaatgcactcaacagtataactgtgcttgtaactgttgattctgatagaccaatt |
12803198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 31 - 169
Target Start/End: Complemental strand, 12733020 - 12732882
Alignment:
| Q |
31 |
gacaatggcagtgaaacattctgcaaatgtggtgaagggtggagttgttccattttcaaaactgaaggccctggtgtaaactctggcaagggctttgctg |
130 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| | |||||||| |||| || | |||| |||||||| ||||||| |
|
|
| T |
12733020 |
gacaatggcagtgaaacattctgcaagtgtggtgaaggatggagttgttccatttttaggactgaaggtcctgatgcagactcaggcaagggatttgctg |
12732921 |
T |
 |
| Q |
131 |
aatgcactcaacagtataactgtgcttgtaactgttgat |
169 |
Q |
| |
|
| ||||||||||| |||||||||| |||||| ||||||| |
|
|
| T |
12732920 |
attgcactcaacaatataactgtgattgtaaatgttgat |
12732882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 31 - 169
Target Start/End: Complemental strand, 12795822 - 12795684
Alignment:
| Q |
31 |
gacaatggcagtgaaacattctgcaaatgtggtgaagggtggagttgttccattttcaaaactgaaggccctggtgtaaactctggcaagggctttgctg |
130 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| | |||||||| |||| || | |||| |||||||| ||||||| |
|
|
| T |
12795822 |
gacaatggcagtgaaacattctgcaagtgtggtgaaggatggagttgttccatttttaggactgaaggtcctgatgcagactcaggcaagggatttgctg |
12795723 |
T |
 |
| Q |
131 |
aatgcactcaacagtataactgtgcttgtaactgttgat |
169 |
Q |
| |
|
| ||||||||||| |||||||||| |||||| ||||||| |
|
|
| T |
12795722 |
attgcactcaacaatataactgtgattgtaaatgttgat |
12795684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University