View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0333_low_2 (Length: 398)
Name: NF0333_low_2
Description: NF0333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0333_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 2e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 11 - 143
Target Start/End: Complemental strand, 23750009 - 23749877
Alignment:
| Q |
11 |
gaatgagagaaaagtgacggaccattaagttattgttagaagaaacacccaacttaactaagaaatgtgcacaactttttatttccacaaataaaaatac |
110 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23750009 |
gaatgagagaaaagtggcagaccattaagttattgttagaagaaacactcaacttaactaagaagtgtgcacaactttttatttccacaaataaaaatac |
23749910 |
T |
 |
| Q |
111 |
tatttattgatgttattcaataagataataatt |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
23749909 |
tatttattgatgttattcaataagataataatt |
23749877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University