View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0333_low_6 (Length: 247)
Name: NF0333_low_6
Description: NF0333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0333_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 10299389 - 10299439
Alignment:
| Q |
1 |
ggcatggattttttccaccactgctgtggaaacaattagaccttttaattg |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10299389 |
ggcatggattttttccaccactgctgtggaaacaattagaccttttaattg |
10299439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 51
Target Start/End: Complemental strand, 40204183 - 40204135
Alignment:
| Q |
3 |
catggattttttccaccactgctgtggaaacaattagaccttttaattg |
51 |
Q |
| |
|
||||||| |||||||||||| || ||||||||||| ||||||| ||||| |
|
|
| T |
40204183 |
catggatcttttccaccacttctatggaaacaatttgacctttcaattg |
40204135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 51
Target Start/End: Complemental strand, 40208316 - 40208268
Alignment:
| Q |
3 |
catggattttttccaccactgctgtggaaacaattagaccttttaattg |
51 |
Q |
| |
|
||||||| |||||||||||| || ||||||||||| ||||||| ||||| |
|
|
| T |
40208316 |
catggatcttttccaccacttctatggaaacaatttgacctttcaattg |
40208268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University