View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0333_low_8 (Length: 219)

Name: NF0333_low_8
Description: NF0333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0333_low_8
NF0333_low_8
[»] chr7 (1 HSPs)
chr7 (106-214)||(33267846-33267954)


Alignment Details
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 106 - 214
Target Start/End: Complemental strand, 33267954 - 33267846
Alignment:
106 atcaaggtatctctaccgttggatatagatcgaacaactctaattcttaatttattaattttattttaaattacatatcataatatgagtcgtctgatct 205  Q
    ||||||||||||||||||||| ||| ||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||||||||||||||    
33267954 atcaaggtatctctaccgttgaataaagatcgaacaactctaattcttactttattaattttactttaaagtacatatcataatatgagtcgtctgatct 33267855  T
206 tcatctcac 214  Q
    |||||||||    
33267854 tcatctcac 33267846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University