View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0335-Insertion-10 (Length: 184)
Name: NF0335-Insertion-10
Description: NF0335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0335-Insertion-10 |
 |  |
|
[»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 3e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 8 - 184
Target Start/End: Complemental strand, 37302709 - 37302533
Alignment:
Q |
8 |
aatacaaaaacacatctctttgtcattttgtttaaacannnnnnnaatcccaaaaaattcttaaaactcgattccaagtctagtctctctctaaaaaatt |
107 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37302709 |
aatacaaaaacacagctctttgtcattttgtttaaacatttttttcatcccaaaaaattcttaaaactcgattccaagtctagtctctctctaaaaaatt |
37302610 |
T |
 |
Q |
108 |
acgagttttcatcctcgaattttttaaatacactgcttctagtccgatttcttctatgaacatgttatttatcgtca |
184 |
Q |
|
|
|||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
37302609 |
acgagttttcatcctcgaatttcttaaatacattgcttctagtccgatttcttctatgaacatgtcatttatcgtca |
37302533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 54 - 155
Target Start/End: Complemental strand, 37302423 - 37302321
Alignment:
Q |
54 |
atcccaaaaaattcttaaaact-cgattccaagtctagtctctctctaaaaaattacgagttttcatcctcgaattttttaaatacactgcttctagtcc |
152 |
Q |
|
|
|||||||||||||||||||| | ||||||||| | |||||| ||||| |||||||||| | ||||||||| |||||| ||||||| || ||||||||| |
|
|
T |
37302423 |
atcccaaaaaattcttaaaaattcgattccaattttagtctaactctagaaaattacgaatgttcatcctcaaattttataaatactttgtttctagtcc |
37302324 |
T |
 |
Q |
153 |
gat |
155 |
Q |
|
|
||| |
|
|
T |
37302323 |
gat |
37302321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University