View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0335-Insertion-4 (Length: 236)
Name: NF0335-Insertion-4
Description: NF0335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0335-Insertion-4 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 156 - 236
Target Start/End: Original strand, 4096042 - 4096120
Alignment:
| Q |
156 |
atgtctttattgacaccttcttcttttcttttgatatgcagtcactgtccaacagtattgaaggcggaaccaaatggttgg |
236 |
Q |
| |
|
||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4096042 |
atgtctttattgacaccttcttcttttgatat--tatgcagtcactgtccaacagtattgaaggcggaaccaaatggttgg |
4096120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 8 - 54
Target Start/End: Original strand, 4095729 - 4095774
Alignment:
| Q |
8 |
ataatgacgagtaggaccgtaaacttgtactttagaggaacatttat |
54 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4095729 |
ataatgacgagtaggac-gtaaacttgtactttagaggaacatttat |
4095774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University