View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0335-Insertion-5 (Length: 181)
Name: NF0335-Insertion-5
Description: NF0335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0335-Insertion-5 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 7e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 7e-94
Query Start/End: Original strand, 8 - 181
Target Start/End: Complemental strand, 5714109 - 5713936
Alignment:
| Q |
8 |
cctattacaccatgcaatatcaagtttatttggagtgtcatcaaaattcaaaataaaacaatttattgctgccattcagtagttggctacatacataccg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5714109 |
cctattacaccatgcaatatcaagtttatttggagtgtcatcaaaattcaaaataaaacaatttattgctgccattcagtagttggctacatacataccg |
5714010 |
T |
|
| Q |
108 |
gtctttgctcaaaaggaacttcaatttccaacccaggatcccagctacctcctgaagatccacttgtttctcca |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5714009 |
gtctttgctcaaaaggaacttcaatttccaacccaggatcccagctacctcctgaagatccacttgtttctcca |
5713936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University