View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0335-Insertion-7 (Length: 424)
Name: NF0335-Insertion-7
Description: NF0335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0335-Insertion-7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 29 - 338
Target Start/End: Original strand, 35194483 - 35194792
Alignment:
Q |
29 |
ttatgttaagtccctaactagtaacactaaattccaacacagacaaattagttacatatattgtttaacttacaagacatttgaaataatgtcgagatgt |
128 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
35194483 |
ttatgttaagtccctaactagttacactaaattccaacacagacaaattagttacatatattgtttaacttacaagacatttgaaataatgtcaagatgt |
35194582 |
T |
 |
Q |
129 |
tgtaacaactaagttgatctacaagacttcaatgtttccctctcgcttttgccctttaactctctcataggattgtcaaactgtggaatattgagtgaat |
228 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35194583 |
tgtaacacctaagttgatctacaagacttcaatgtttccctctcgcttttgccctttaactctctcataggattgtcaaactgtggaatattgagtgaat |
35194682 |
T |
 |
Q |
229 |
gattttgaagtgaggccgtaagtctttatttataggttacggtgctcacccttcgtatggcgagaagggtgatttagtcaataatttatccaaaatcata |
328 |
Q |
|
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
35194683 |
gattttgaagtgaggccgtaagcctttctttataggttacggtgctcacccttcgtatggcgagaagggtgatttagtcaataatttatccgaaatcata |
35194782 |
T |
 |
Q |
329 |
catctaaatc |
338 |
Q |
|
|
|||||||||| |
|
|
T |
35194783 |
catctaaatc |
35194792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University