View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0335-Insertion-8 (Length: 354)
Name: NF0335-Insertion-8
Description: NF0335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0335-Insertion-8 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 6 - 354
Target Start/End: Original strand, 34758433 - 34758781
Alignment:
Q |
6 |
caaacaaccaccacaaaagtagtaagattaatcatggcaaatacacttgcggttattttgtcttaaaatagtagttttatgattggaaatatgtgttaaa |
105 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
34758433 |
caaacaaccaccacaaaagtagtaagattaatcatggcaaatacacttgtggttattttgtcttaaaatagtagttttatgattggaaatatgtgttaga |
34758532 |
T |
 |
Q |
106 |
aaaggcttcacagtaatttaaattgttattttgaactgcttgttcaacattctttttagtattattattggatgaaagtagaaattagaaaaataaacat |
205 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34758533 |
aaaggcttcacagtaatttaaattgttactttgaactgcttgttcaacattctttttagtattattattggatgaaagtagaaattagaaaaataaacat |
34758632 |
T |
 |
Q |
206 |
catggttattggtgaagttcagcttttgagtatgaagaaaccatatacagtaagaccagcataaaagttaggcgtgaaccactgctttaaaaaagaaaca |
305 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
34758633 |
catggttattggtgaagttcagcttttgagtatgaagaaaccatatacagtaagaccagcataaaagttaagcgtgaaccactgctttaaaaaagaaaca |
34758732 |
T |
 |
Q |
306 |
gaaaggacataaataaagtaaactccactaaggtcccccaccaaaaaat |
354 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34758733 |
gaaaggacataaataaagtaaactccactaaggtcccccaccaaaaaat |
34758781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 321 times since January 2019
Visitors: 2755