View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0335_low_9 (Length: 262)
Name: NF0335_low_9
Description: NF0335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0335_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 39 - 236
Target Start/End: Original strand, 13868530 - 13868727
Alignment:
| Q |
39 |
acccttgtctcatcaatctcatcaggtacccttttcttcttcattccatcaattcttcactacccagattctatttcctcttttttactacctttgaatt |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13868530 |
acccttgtctcatcaatctcatcaggtacccttttcttcttcattccatcaattcttcactacccagattctatttcctcttttttactacctttgaatt |
13868629 |
T |
|
| Q |
139 |
gggtcaacacaaagttgaatttcaaacgacttcaattgagatcttattcaacaatattgaaagttgagaattcattagttggttaggtagatatcttc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
13868630 |
gggtcaacacaaagttgaatttcaaacgacttcaattgagatcttattcaacaatattcaaggttgagaattcattagttggttaggtagatatcttc |
13868727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 477 times since January 2019
Visitors: 2766