View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0337_high_16 (Length: 201)

Name: NF0337_high_16
Description: NF0337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0337_high_16
NF0337_high_16
[»] chr7 (1 HSPs)
chr7 (69-177)||(33267846-33267954)


Alignment Details
Target: chr7 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 69 - 177
Target Start/End: Original strand, 33267846 - 33267954
Alignment:
69 gtgagatgaagatcagacgactcatattatgatatgtaatttaaaataaaattaataaattaagaattagagttgttcgatctatatccaacggtagaga 168  Q
    |||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| ||||||||||||||||||||||| ||| ||||||||||||    
33267846 gtgagatgaagatcagacgactcatattatgatatgtactttaaagtaaaattaataaagtaagaattagagttgttcgatctttattcaacggtagaga 33267945  T
169 taccttgat 177  Q
    |||||||||    
33267946 taccttgat 33267954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University