View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0337_high_7 (Length: 293)
Name: NF0337_high_7
Description: NF0337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0337_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 6 - 119
Target Start/End: Original strand, 35535057 - 35535170
Alignment:
Q |
6 |
agcagcagagagcaacaaaacacttgcaagccattttttaagcttcatcacatccaattatcacctaaaccagcaagttcagtccaatacttctgcaagg |
105 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35535057 |
agcagcagtgagcaacaaaacacttgcaagccattttttaagcttcatcacatccaataatcacctaaaccagcaagttcagtccaatacttctgcaagg |
35535156 |
T |
 |
Q |
106 |
taaagccctaactg |
119 |
Q |
|
|
|||||||||||||| |
|
|
T |
35535157 |
taaagccctaactg |
35535170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University