View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0337_high_8 (Length: 284)
Name: NF0337_high_8
Description: NF0337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0337_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 170 - 278
Target Start/End: Complemental strand, 33267954 - 33267846
Alignment:
| Q |
170 |
atcaaggtatctctaccgttggatatagatcgaacaactctaattcttaatttattaattttattttaaattacatatcataatatgagtcgtctgatct |
269 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||||||| ||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33267954 |
atcaaggtatctctaccgttgaataaagatcgaacaactctaattcttactttattaattttactttaaagtacatatcataatatgagtcgtctgatct |
33267855 |
T |
|
| Q |
270 |
tcatctcac |
278 |
Q |
| |
|
||||||||| |
|
|
| T |
33267854 |
tcatctcac |
33267846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 332 times since January 2019
Visitors: 2756