View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0337_low_13 (Length: 275)
Name: NF0337_low_13
Description: NF0337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0337_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 21 - 129
Target Start/End: Complemental strand, 33267954 - 33267846
Alignment:
| Q |
21 |
atcaaggtatctctaccgttggatatagatcgaacaactctaattcttaatttattaattttattttaaattacatatcataatatgagtcgtctgatct |
120 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||||||| ||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33267954 |
atcaaggtatctctaccgttgaataaagatcgaacaactctaattcttactttattaattttactttaaagtacatatcataatatgagtcgtctgatct |
33267855 |
T |
|
| Q |
121 |
tcatctcac |
129 |
Q |
| |
|
||||||||| |
|
|
| T |
33267854 |
tcatctcac |
33267846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 212 - 269
Target Start/End: Complemental strand, 1767480 - 1767423
Alignment:
| Q |
212 |
cttacacgaattccacaacctgcaaaatgactattatcatgcaccaaagttcttaacc |
269 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| |||||||||| ||||||| |||||| |
|
|
| T |
1767480 |
cttacacgaaatccacaacatgcaaaatgacacttatcatgcaacaaagttgttaacc |
1767423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 632 times since January 2019
Visitors: 2780