View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0337_low_15 (Length: 218)
Name: NF0337_low_15
Description: NF0337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0337_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 6 - 114
Target Start/End: Complemental strand, 33267954 - 33267846
Alignment:
Q |
6 |
atcaaggtatctctaccgttggatatagatcgaacaactctaattcttaatttattaattttattttaaattacatatcataatatgagtcgtctgatct |
105 |
Q |
|
|
||||||||||||||||||||| ||| ||||||||||||||||||||||| ||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
T |
33267954 |
atcaaggtatctctaccgttgaataaagatcgaacaactctaattcttactttattaattttactttaaagtacatatcataatatgagtcgtctgatct |
33267855 |
T |
 |
Q |
106 |
tcatctcac |
114 |
Q |
|
|
||||||||| |
|
|
T |
33267854 |
tcatctcac |
33267846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 499 times since January 2019
Visitors: 2773