View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0337_low_4 (Length: 458)
Name: NF0337_low_4
Description: NF0337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0337_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 257 - 448
Target Start/End: Complemental strand, 42019313 - 42019122
Alignment:
| Q |
257 |
gtaaaacctctgctttacactttctcaaacattggtggctttcgttagaaaatcgtgttcatcttcatcaatcgtttaaaattcctctctatgatcataa |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42019313 |
gtaaaacctctgctttacactttctcaaacattggtggctttcgttagaaaatcgtcttcatcttcatcaatcgtttaaaattcctctctatgatcataa |
42019214 |
T |
 |
| Q |
357 |
tttccgggaaaatcaactttaccggaaaattctcacctaccttgattcactaccttccgttcaagatgctgatttcacaaacctgttctctg |
448 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42019213 |
tttccgggaaaatcaactttaccggaaaattctcacctaccttgattcactaccttccgttcaagatgctgatttcacaaacctgttctctg |
42019122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 30 - 202
Target Start/End: Complemental strand, 42019523 - 42019368
Alignment:
| Q |
30 |
gatatatacaaagtgcatcaacaacattacacatttacattccaatattcccaaatccaaacgcacgcaccattatattcattgattcttcaatctaacc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42019523 |
gatatatacaaagtgcatcaacaacattacacatttacattccaatattcccaaatccaaacgcacgcaccattatattcattgat-------------- |
42019438 |
T |
 |
| Q |
130 |
ctatcttagatcaatatttattattaaattctcaactgaattatgatttggcttggggtcacttccatgacaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42019437 |
---tcttagatcaatatttattattaaattctcaactgaattatgatttggcttggggtcacttccatgacaa |
42019368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University