View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0340_high_13 (Length: 286)
Name: NF0340_high_13
Description: NF0340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0340_high_13 |
 |  |
|
| [»] scaffold0280 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 29 - 284
Target Start/End: Complemental strand, 37799507 - 37799252
Alignment:
| Q |
29 |
agtatccttacacttttggaccataggttggagggaaatgctgacattgaggaagtgactgaaatgataaaagttgcttcttggtgtgtccaagaaaatg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37799507 |
agtatccttacacttttggaccataggttggagggaaatgctgacattgaggaagtgactgaaatgataaaagttgcttcttggtgtgtccaagaaaatg |
37799408 |
T |
 |
| Q |
129 |
aaactcagaggccaaccatgcgtcaggcagttcaaattctcgaggggaccttgaatgtgaatttgccaccaattccaagattcaatcaagtgtttgtaga |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37799407 |
aaactcagaggccaaccatgcgtcaggcagttcaaattctcgaggggaccttgaatgtgaatttgccaccaattccaagattcaatcaagtgtttgtaga |
37799308 |
T |
 |
| Q |
229 |
taactaagagaattttctctaccaaattcacaggccaaaagatattcttcgacatc |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| |||| ||||| |
|
|
| T |
37799307 |
taactaagagaattttctctaccaaattcacaggccaaaaggtatgcttcaacatc |
37799252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 41 - 207
Target Start/End: Original strand, 37766251 - 37766417
Alignment:
| Q |
41 |
cttttggaccataggttggagggaaatgctgacattgaggaagtgactgaaatgataaaagttgcttcttggtgtgtccaagaaaatgaaactcagaggc |
140 |
Q |
| |
|
|||||||||| ||||||| |||||||||| |||||||| || || | ||| || ||||| |||||||||||||||||||| ||||||| ||| |||| |
|
|
| T |
37766251 |
cttttggaccctaggttgcagggaaatgcggacattgaagaggttgcgcgaataattaaagtcgcttcttggtgtgtccaagacaatgaaaatcaaaggc |
37766350 |
T |
 |
| Q |
141 |
caaccatgcgtcaggcagttcaaattctcgaggggaccttgaatgtgaatttgccaccaattccaag |
207 |
Q |
| |
|
|||| ||| |||||| |||||||||||| ||||| | ||| | ||||||||||||||||||||||| |
|
|
| T |
37766351 |
caacaatgggtcaggtagttcaaattcttgagggaattttggaagtgaatttgccaccaattccaag |
37766417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0280 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0280
Description:
Target: scaffold0280; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 102 - 171
Target Start/End: Original strand, 16500 - 16569
Alignment:
| Q |
102 |
ttgcttcttggtgtgtccaagaaaatgaaactcagaggccaaccatgcgtcaggcagttcaaattctcga |
171 |
Q |
| |
|
|||||||||||||||| ||||| ||||| |||| |||||| | ||| |||||| ||||||||| ||||| |
|
|
| T |
16500 |
ttgcttcttggtgtgttcaagatgatgaagctcataggccatcgatgggtcaggtagttcaaatcctcga |
16569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University