View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0340_high_15 (Length: 257)
Name: NF0340_high_15
Description: NF0340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0340_high_15 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 30 - 257
Target Start/End: Original strand, 15115286 - 15115513
Alignment:
Q |
30 |
gaaattgtaatcagaagtgtagcatttataggcgttccagttttcggatgtacaagagcgaaccaaggaggaatcatgtgcgaacgtgcgatgtgagcaa |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15115286 |
gaaattgtaatcagaagtgtagcatttataggcgttccagttttcggatgtacaagagcgaaccaaggaggaatcatgtgcgaacgtgcgatgtgagcaa |
15115385 |
T |
 |
Q |
130 |
tataacgcgcttgtcctaatcttcctactaaaagcactgttgtcatacctttcaatgcaccaaaagctactacatattttgcccaattcattccaacttt |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15115386 |
tataacgcgcttgtcctaatcttcctactaaaagcactgttgtcatacctttcaatgcaccaaaagctactacatattttgcccaattcattccaacttt |
15115485 |
T |
 |
Q |
230 |
ctgaaatgcaactgagaaagctgcacct |
257 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
15115486 |
ctgaaatgcaactgagaaagctgcacct |
15115513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University