View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0340_low_17 (Length: 257)
Name: NF0340_low_17
Description: NF0340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0340_low_17 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 30 - 257
Target Start/End: Original strand, 15115286 - 15115513
Alignment:
| Q |
30 |
gaaattgtaatcagaagtgtagcatttataggcgttccagttttcggatgtacaagagcgaaccaaggaggaatcatgtgcgaacgtgcgatgtgagcaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15115286 |
gaaattgtaatcagaagtgtagcatttataggcgttccagttttcggatgtacaagagcgaaccaaggaggaatcatgtgcgaacgtgcgatgtgagcaa |
15115385 |
T |
 |
| Q |
130 |
tataacgcgcttgtcctaatcttcctactaaaagcactgttgtcatacctttcaatgcaccaaaagctacaacatattttgcccaattcattccaacttt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15115386 |
tataacgcgcttgtcctaatcttcctactaaaagcactgttgtcatacctttcaatgcaccaaaagctactacatattttgcccaattcattccaacttt |
15115485 |
T |
 |
| Q |
230 |
ctgaaatgcaactgagaaagctgcacct |
257 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
15115486 |
ctgaaatgcaactgagaaagctgcacct |
15115513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University