View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0340_low_19 (Length: 248)
Name: NF0340_low_19
Description: NF0340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0340_low_19 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 23 - 248
Target Start/End: Original strand, 401459 - 401684
Alignment:
Q |
23 |
catcatagaccaggtgcacagttcaaacctgtagaagtttaactaaagtagatcttgcttggctaatgcgcccactttttctgcaaagagaagcaaaatt |
122 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
401459 |
catcatagaccaggtgcacagttcaaacctgtagaagtttaactaaagtagatcttgcttggctaatgcgcccactttttctgcaaagagaagcaaaatt |
401558 |
T |
 |
Q |
123 |
gagccatgtttcaatgtcttcagctggtggcagcacaagtgttctaacagccaaaagtgcctgccaaacctgccaaaaagcatcacaaagtcagaggaag |
222 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
401559 |
gagccatgtttcaatgtcttcagctggtggcagcacaagtgttctaacagccaaaagtgcctgccaaacctgccaaaaagcatcacaaagtcagaggaag |
401658 |
T |
 |
Q |
223 |
ggcattaaaagccccaatttgttaaa |
248 |
Q |
|
|
|| ||||||||||| ||||||||||| |
|
|
T |
401659 |
ggaattaaaagcccaaatttgttaaa |
401684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 425 times since January 2019
Visitors: 2762