View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0340_low_6 (Length: 474)
Name: NF0340_low_6
Description: NF0340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0340_low_6 |
 | |
|
| [»] chr2 (5 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 3e-77; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 3e-77
Query Start/End: Original strand, 272 - 474
Target Start/End: Original strand, 20969399 - 20969598
Alignment:
| Q |
272 |
aattttcaggatgaatcattcattgctgatatctcagtgccggtttcctgccttattgcagtcacaagcaaggagtaagcctgctggcaccgtacttcat |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20969399 |
aattttcaggatgaatcattcattgctgatatcttggtgccggtttcctgccttattgcagtcacaagcaaggagtaagcctgctggcaccg----tcat |
20969494 |
T |
|
| Q |
372 |
ccagaataataaa-ctggcattagaaccattctgttcaaaatctttcttaataaaactcagttcttaatatagcaagaagagtcgatggcctcaacgcaa |
470 |
Q |
| |
|
||||||||||||| ||| |||||||| ||||||||||||||||||||||||| ||||||||||||| ||||||||||||| ||||||||||||||| ||| |
|
|
| T |
20969495 |
ccagaataataaacctgtcattagaaacattctgttcaaaatctttcttaattaaactcagttcttgatatagcaagaagtgtcgatggcctcaacccaa |
20969594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 151 - 257
Target Start/End: Original strand, 20968791 - 20968900
Alignment:
| Q |
151 |
agataacatttgaagcaactcactgcttgatagttgttttgttttataactatgaac---tcttgtttgtgtaaagcaagcgagtctccaacactataag |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20968791 |
agataacatttgaagcaactcactgcttgatagttgttttgttttataactatgaactgatcttgtttgtgtaaagcaagcgagtctccaacactataag |
20968890 |
T |
|
| Q |
248 |
taattgaagt |
257 |
Q |
| |
|
||| |||||| |
|
|
| T |
20968891 |
taaatgaagt |
20968900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 158 - 245
Target Start/End: Original strand, 20981628 - 20981716
Alignment:
| Q |
158 |
atttgaagcaactcactgcttgatagttgttttgttttataactatgaactcttg-tttgtgtaaagcaagcgagtctccaacactata |
245 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| ||||| |
|
|
| T |
20981628 |
atttgaagcaactcattgcttgatagttgttttgttttataactatgaactcttgttttgtgtaaagcaagaaagtctccaactctata |
20981716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 53 - 115
Target Start/End: Original strand, 20968690 - 20968752
Alignment:
| Q |
53 |
aaaggaagatcgagtcactggagctccaatatcttcatttatagcacaaataattacgttctt |
115 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
20968690 |
aaaggaagatcgagtcactagagctgcaatatcttcatttatagcacaaacaattatgttctt |
20968752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 53 - 115
Target Start/End: Original strand, 20981519 - 20981582
Alignment:
| Q |
53 |
aaaggaagatcgagtcactggagctccaatatc-ttcatttatagcacaaataattacgttctt |
115 |
Q |
| |
|
|||||||||| | |||||||||||| ||||||| |||| |||||||||||| ||||| |||||| |
|
|
| T |
20981519 |
aaaggaagattgggtcactggagctgcaatatctttcaattatagcacaaacaattatgttctt |
20981582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 420 times since January 2019
Visitors: 2762