View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0340_low_7 (Length: 463)
Name: NF0340_low_7
Description: NF0340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0340_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 9298801 - 9298651
Alignment:
| Q |
1 |
tttcttctcgatctaatgcaaatgtgtggtcatggattgtaaagtattctcggaccaggcttcattccccccaattatatgcttccatggactatacata |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9298801 |
tttcttctcgatctaatgcaaatttgtggtcatggattgtaaagtattctcggaccaggcttcattccccccaattatatgcttccatggactatacata |
9298702 |
T |
 |
| Q |
101 |
cactttcataggtttgatttcatttcatttctctctctaaaattatatata |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9298701 |
cactttcataggtttgatttcatttcatttctctctctaaaattatatata |
9298651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 140; E-Value: 4e-73
Query Start/End: Original strand, 191 - 370
Target Start/End: Complemental strand, 9298611 - 9298431
Alignment:
| Q |
191 |
cctaaatataggtagatctgaatcatgggtttttgatttttggttgaattta-gatttatgtaatttgcagattggtgtaatgatgaagtattttgacan |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9298611 |
cctaaatataggtagatctgaatcatgggtttttgatttttggttgagtttaagatttatgtaatttgcagattggtgtaatgatgaaacattttgacat |
9298512 |
T |
 |
| Q |
290 |
nnnnnncttctctcttcctcaaaaggttttcatcattacatccttttcgtgtttctttctctgattttgttatgatgatgt |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9298511 |
ttttttcttctctcttcctcaaaaggttttcatcattacatccttttcgtgtttctttctctgattttgttatgatgatgt |
9298431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University