View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0340_low_9 (Length: 337)
Name: NF0340_low_9
Description: NF0340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0340_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 12 - 243
Target Start/End: Original strand, 9298674 - 9298907
Alignment:
| Q |
12 |
atgaaatgaaatcaaacctatgaaagtgtatgtatagtccatggaagcatataattggggggaatgaagcctggtccgagaatactttacaatccatgac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9298674 |
atgaaatgaaatcaaacctatgaaagtgtatgtatagtccatggaagcatataattggggggaatgaagcctggtccgagaatactttacaatccatgac |
9298773 |
T |
|
| Q |
112 |
cacaaatttgcattagatcgagaagaaagcgtcctcgagccagacaacattcccctcaaaaaataaagcttcccaatagtctttttcttagagttttgta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9298774 |
cacaaatttgcattagatcgagaagaaagcgtcctcgagccagacaacattcccctcaaaaaataaagcttcccaatagtctttttcttagagttttgta |
9298873 |
T |
|
| Q |
212 |
atggt--cacacacacactttgtgttctcttttg |
243 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
9298874 |
atggtcacacacacacactttgtgttctcttttg |
9298907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 401 times since January 2019
Visitors: 2761