View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0341_high_3 (Length: 315)
Name: NF0341_high_3
Description: NF0341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0341_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 25 - 303
Target Start/End: Original strand, 482306 - 482583
Alignment:
| Q |
25 |
catcagaagcatactctattattaccttggttcaggcttctttgaagaaggaactgcagcatctatcccaacacaacgtaaatgttttgccaagccttca |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
482306 |
catcagaagcatactctattattaccttggttcaggcttctttgaagaaggaactgcagcatctatcccaacacaacgtaaatgttttgccaagccttca |
482405 |
T |
 |
| Q |
125 |
acctgagtaaattccttaccagattcatgctcatatttaaattttataaatacacaatcattcaaattgttcattaaaataaaatcccctttctttttgg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
482406 |
acctgagtaaattccttaccagattcatgctcatatttaaattttataaatacacaatcattcaaattgttcattaaaataaaatcccctttctttttgg |
482505 |
T |
 |
| Q |
225 |
ataacatgtttcaattatatattcataaaacagaagtcaaaatattgacactgataacgatgcaaatggctcatatatt |
303 |
Q |
| |
|
|| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
482506 |
at-atatgtttcaattatatattcataaaacagaagtcaaaatattgacactgataacgatgcaaatggctcatatatt |
482583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University