View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0341_low_4 (Length: 306)
Name: NF0341_low_4
Description: NF0341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0341_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 84 - 210
Target Start/End: Original strand, 29108474 - 29108600
Alignment:
| Q |
84 |
gcacagagctgatgcaccagcatggaatgccgctgtcgctcatatccgaaggaagctgaactctgatatgctcaaccttgtggatttcaattttcatttc |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29108474 |
gcacagagctgatgcaccagcatggaatgccgctgtcgctcatatccgaaggaagctgaactctgatatgctcaaccttgtggatttcaattttcatttc |
29108573 |
T |
|
| Q |
184 |
tacagaaatcagattcatgaactcttt |
210 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
29108574 |
tacagaaatcagattcatgaactcttt |
29108600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 100 - 210
Target Start/End: Original strand, 29075330 - 29075440
Alignment:
| Q |
100 |
ccagcatggaatgccgctgtcgctcatatccgaaggaagctgaactctgatatgctcaaccttgtggatttcaattttcatttctacagaaatcagattc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29075330 |
ccagcatggaatgccgctgtcgctcatatccgaaggaagctgaactctgatatgctcaaccttgtggatttcaattttcatttccacagaaatcagattc |
29075429 |
T |
|
| Q |
200 |
atgaactcttt |
210 |
Q |
| |
|
||||||||||| |
|
|
| T |
29075430 |
atgaactcttt |
29075440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 122 - 187
Target Start/End: Complemental strand, 4366002 - 4365937
Alignment:
| Q |
122 |
ctcatatccgaaggaagctgaactctgatatgctcaaccttgtggatttcaattttcatttctaca |
187 |
Q |
| |
|
||||||| ||||||| |||||||||||| | | |||||||||||| || | |||||||||||||| |
|
|
| T |
4366002 |
ctcatataagaaggaatctgaactctgatgtacacaaccttgtggacttgagttttcatttctaca |
4365937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University