View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_1D_high_11 (Length: 242)
Name: NF0342_1D_high_11
Description: NF0342_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_1D_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 7 - 231
Target Start/End: Complemental strand, 45441967 - 45441743
Alignment:
| Q |
7 |
ggacaacgggtggatttagtcgattttgagccgaaaaacatcaaccgcaacaaaacccatgtttgtagatctcaatcgatttttcgtccattcaattgct |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45441967 |
ggacaacgggtggatttagtcgattttgagccgaaaaacatcaaccgcaacaaaacccatgtttgtagatctcaatcgatttttcgtccattcaattgct |
45441868 |
T |
|
| Q |
107 |
ccggggatggtgaagggtgaagcaggaggcgggtgggtcggttgacaggtgaaacaagtgtgaaaacgaatgagagaaaataggaagaatagcttcagat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45441867 |
ccggggatggtgaagggtgaagcaggaggcggatgagtcggttgacaggtgaaacaagtgtgaaaacgaatgagagaaaataggaagaatagctccagat |
45441768 |
T |
|
| Q |
207 |
ctagccgtcaacaccattgtttcat |
231 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
45441767 |
ctagccgtcaacaccattgtttcat |
45441743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15 times since January 2019
Visitors: 2898