View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_1D_high_14 (Length: 201)
Name: NF0342_1D_high_14
Description: NF0342_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_1D_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 76; Significance: 2e-35; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 55 - 179
Target Start/End: Complemental strand, 52545238 - 52545109
Alignment:
| Q |
55 |
tagaaggcacaacaatcaaatgcatacatcaaagagccataaactaaagagagaagacgtcg-----gnnnnnnnnnnaccaggtgagttagctgtaaca |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52545238 |
tagaaggcacaacaatcaaatgcatacatcaaagagccataaactaaagagagaagacgtcgacttttttttttttttaccaggtgagttagctgtaaca |
52545139 |
T |
 |
| Q |
150 |
aaaacaatcccaatcaaaacataacaaact |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
52545138 |
aaaacaatcccaatcaaaacataacaaact |
52545109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University