View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0342_1D_high_9 (Length: 268)

Name: NF0342_1D_high_9
Description: NF0342_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0342_1D_high_9
NF0342_1D_high_9
[»] chr2 (1 HSPs)
chr2 (95-181)||(23776704-23776787)
[»] chr7 (1 HSPs)
chr7 (119-180)||(32298332-32298393)


Alignment Details
Target: chr2 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 95 - 181
Target Start/End: Complemental strand, 23776787 - 23776704
Alignment:
95 cttttcttgtttttctcctgatgatgatggatgatttaagccaacaacgtaatcacagggtctgatactttaccaccgtactgtttc 181  Q
    ||||||||||||||||||||||||||   ||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||    
23776787 cttttcttgtttttctcctgatgatg---gattatttaagccaacaacgtaatcacagggtctgatactttaccgccgtattgtttc 23776704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 32298332 - 32298393
Alignment:
119 tgatggatgatttaagccaacaacgtaatcacagggtctgatactttaccaccgtactgttt 180  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |||||    
32298332 tgatggatgatttaagccaacaacgtaatcacatggtctgatactttaccgccgtattgttt 32298393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2055 times since January 2019
Visitors: 2888