View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_1D_low_11 (Length: 312)
Name: NF0342_1D_low_11
Description: NF0342_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_1D_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 95 - 299
Target Start/End: Complemental strand, 23776787 - 23776586
Alignment:
| Q |
95 |
cttttcttgtttttctcctgatgatgatggatgatttaagccaacaacgtaatcacagggtctgatactttaccaccgtactgtttcttcacatcgattg |
194 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| ||| |
|
|
| T |
23776787 |
cttttcttgtttttctcctgatgatg---gattatttaagccaacaacgtaatcacagggtctgatactttaccgccgtattgtttcttcacatcgcttg |
23776691 |
T |
|
| Q |
195 |
ttttctcaattttttccaatcggttaacctccaagtcttcaatcgcattatttctgtcgctaccgttttcacaagtttgctctccacctcaccgatttcc |
294 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| | | ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23776690 |
ttttctcaatttcttccaatcggttaacctccaagtcttcaatcgcattatttatgttgttgtcgttttcacaagtttgctctccacctcaccggtttcc |
23776591 |
T |
|
| Q |
295 |
tgttc |
299 |
Q |
| |
|
||||| |
|
|
| T |
23776590 |
tgttc |
23776586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 119 - 204
Target Start/End: Original strand, 32298332 - 32298418
Alignment:
| Q |
119 |
tgatggatgatttaagccaacaacgtaatcacagggtctgatactttaccaccgtactg-tttcttcacatcgattgttttctcaat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| || ||| ||||||||| ||||||| ||||| |
|
|
| T |
32298332 |
tgatggatgatttaagccaacaacgtaatcacatggtctgatactttaccgccgtattgtttttttcacatcgcttgttttgtcaat |
32298418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4 times since January 2019
Visitors: 2894