View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_1D_low_13 (Length: 298)
Name: NF0342_1D_low_13
Description: NF0342_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_1D_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 23 - 226
Target Start/End: Original strand, 52285638 - 52285840
Alignment:
| Q |
23 |
catacttgacaggtaagcaattataattccatagcacattacatgaaaagactggttctctttttcttgtttgccaccatttaaacacatagctgaattt |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52285638 |
catacttgacaggtaagcaattataattccatatcacattacatgaaaagactggttctctttttcttgtttgccaccatttaaacacatagctgaattt |
52285737 |
T |
 |
| Q |
123 |
gca-ttagtagatttatttatggaaacttgtctcccttatattagctaatttttgtcatttgtgttccaaattgaagtttatcctttcagaagatattgt |
221 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52285738 |
gcatttagtagatttatttatggaaacttgtctcccttatattagctaatttttgtcatt--tgttccaaattgaagtttatcctttcagaagatattgt |
52285835 |
T |
 |
| Q |
222 |
aatat |
226 |
Q |
| |
|
||||| |
|
|
| T |
52285836 |
aatat |
52285840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 288
Target Start/End: Original strand, 52285900 - 52285929
Alignment:
| Q |
259 |
ccactacaacaatttgagttatgatgtcca |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
52285900 |
ccactacaacaatttgagttatgatgtcca |
52285929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University