View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_1D_low_16 (Length: 268)
Name: NF0342_1D_low_16
Description: NF0342_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_1D_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 95 - 181
Target Start/End: Complemental strand, 23776787 - 23776704
Alignment:
| Q |
95 |
cttttcttgtttttctcctgatgatgatggatgatttaagccaacaacgtaatcacagggtctgatactttaccaccgtactgtttc |
181 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
23776787 |
cttttcttgtttttctcctgatgatg---gattatttaagccaacaacgtaatcacagggtctgatactttaccgccgtattgtttc |
23776704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 32298332 - 32298393
Alignment:
| Q |
119 |
tgatggatgatttaagccaacaacgtaatcacagggtctgatactttaccaccgtactgttt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| ||||| |
|
|
| T |
32298332 |
tgatggatgatttaagccaacaacgtaatcacatggtctgatactttaccgccgtattgttt |
32298393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University