View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_1D_low_22 (Length: 240)
Name: NF0342_1D_low_22
Description: NF0342_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_1D_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 14212334 - 14212106
Alignment:
| Q |
1 |
agcagattcacaaaagatgttgttgctttatcgatctcgaaacggatagaaaaaatgagtattgatttaaattgccgtgtcgaggatttattaatcgaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14212334 |
agcagattcacaaaagatgttgttgctttatcgatctcgaaacggatagaaaaaatgagtattgatttaaattgccgtgtcgaggatttattaatcgaag |
14212235 |
T |
|
| Q |
101 |
aagcattgcagccactagaattctatctctttgatcatgcaagcagaaatcatagactcggccnnnnnnnccgcgaagaaagttctaagatgaaattgca |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14212234 |
aagcattgcagccactagaattccatctctttgatcatgcaagcagaaatcataaactcggcccgaaaaaccgcgaagaaagttctaagatgaaattgca |
14212135 |
T |
|
| Q |
201 |
aacattagaaaaatgtggtgaagagtata |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
14212134 |
aacattagaaaaatgtggtgaagagtata |
14212106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2067 times since January 2019
Visitors: 2890