View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_1D_low_23 (Length: 234)
Name: NF0342_1D_low_23
Description: NF0342_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_1D_low_23 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 7 - 234
Target Start/End: Complemental strand, 43418412 - 43418185
Alignment:
| Q |
7 |
gatcaatgcatttggataaaattttgatggacacaacaaaagttgggtttagttggcaatgatagatagctgctttcaataaaatcagtggatactttct |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43418412 |
gatcaatgcatttggataaaattttgatggacacaacaaaagttgggtttagtgggcaatgatagatagctgctttcaataaaatcagtggatactttct |
43418313 |
T |
|
| Q |
107 |
gaagatgatgattatgagtagaagaattgatgctgccagtgccagaaaagaagaataacacataaatgtcacttgttagtgagaaagcagcctcaactaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43418312 |
gaagatgatgattatgagtagaagaattgatgctgccagtgccagaaaagaagaataacacataaatgtcacttgttagtgagaaagcagcctcaactaa |
43418213 |
T |
|
| Q |
207 |
ctcctccatgcatgaatgcatcaattcc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
43418212 |
ctcctccatgcatgaatgcatcaattcc |
43418185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 15 - 207
Target Start/End: Complemental strand, 43406519 - 43406330
Alignment:
| Q |
15 |
catttggataaaattttgatggacacaacaaaagttgggtttagttggcaatgatagatagctgctttcaataaaatcagtggatactttctgaagatga |
114 |
Q |
| |
|
||||| |||||||||||| || || ||||||||||||| ||||| |||||| |||| ||||||||||||||||||||||||||| || | ||||||||| |
|
|
| T |
43406519 |
catttagataaaattttggcggccataacaaaagttgggattagtgggcaatcatagctagctgctttcaataaaatcagtggattctatgtgaagatga |
43406420 |
T |
|
| Q |
115 |
tgattatgagtagaagaattgatgctgccagtgccagaaaagaagaataacacataaatgtcacttgttagtgagaaagcagcctcaactaac |
207 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| | ||||||| || |||| |||||| |
|
|
| T |
43406419 |
tgat---gagtagaagaattgatgctgccaatgcccgaaaagaagaataacacataaatgtcacttgtgaatgagaaaacaacctcgactaac |
43406330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2008 times since January 2019
Visitors: 2879