View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_1D_low_27 (Length: 218)
Name: NF0342_1D_low_27
Description: NF0342_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0342_1D_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 38 - 197
Target Start/End: Original strand, 18721343 - 18721502
Alignment:
Q |
38 |
cctgctcttcttcctttaccttcacttcaacaactacctttcattccatctttccctcaaaatctcaaaacccatttgcacaaacttccatgcaaactca |
137 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18721343 |
cctgctcttcttcctttaccttcacttcaacaactacctttcattccatctttccctcaaaatctcaaaacccatttgcacaaacttccatgcaaactca |
18721442 |
T |
 |
Q |
138 |
acacttctccttcatctgaatacaatctttctcaactttcacttgatcctggtaagtaac |
197 |
Q |
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18721443 |
atacttctccttcatctgaatacaatctttctcaactttcacttgatcctggtaagtaac |
18721502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 8 - 42
Target Start/End: Complemental strand, 39076841 - 39076807
Alignment:
Q |
8 |
atgaatagaaccgggtttatggttaattcgcctgc |
42 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
39076841 |
atgaatagaaccgggtttatggttaattcgcctgc |
39076807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2056 times since January 2019
Visitors: 2888