View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_1D_low_30 (Length: 208)
Name: NF0342_1D_low_30
Description: NF0342_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_1D_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 7 - 202
Target Start/End: Original strand, 47705315 - 47705510
Alignment:
| Q |
7 |
agtttaaagtacttaagnnnnnnnggaagatattcatacactagtacttctttatcttttcctttccattgatctagtaatgtctttctaatcataccat |
106 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47705315 |
agtttaaagtacttaagtttttttggaagatattcatacactagtacttctttatcttttcctttccattgatctagtaatgtctttctaatcataccat |
47705414 |
T |
 |
| Q |
107 |
gttcccctccagcaaagaaagcaagtatagaacgattatttgggtctttgcttggaattggtgagctcaacttgtaaccttgtaggttcatttcag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47705415 |
gttcccctccagcaaagaaagcaagtatagaacgattatttgattctttgcttggaattggtgagctcaacttgtaaccttgtaggttcatttcag |
47705510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University