View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_1D_low_31 (Length: 207)
Name: NF0342_1D_low_31
Description: NF0342_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_1D_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 3 - 204
Target Start/End: Complemental strand, 4708365 - 4708164
Alignment:
| Q |
3 |
tgatatgaaaaccttaatggtatggaatccatgaccannnnnnnnaaagaagaatccatgataattttgcagatagtcgttgacgccctaattgatccta |
102 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| || ||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
4708365 |
tgatatgaaaaccttaatggtatagaatccatgatcattttttttaaagaagaatccatgatcattttgcagatagtcgttgacaccctacttgatccta |
4708266 |
T |
 |
| Q |
103 |
aagtggttataagatatgacccaaagtcactggttagagatcttgctgacctaatagagagatacacgaagtcgcaggttactggctgaaacatactttt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
4708265 |
aagtggttataagatatgacccaaagtcactggttagagatcttgctgacctaatagagagatacacgaagtcgcaagttactggctgaatcatactttt |
4708166 |
T |
 |
| Q |
203 |
ga |
204 |
Q |
| |
|
|| |
|
|
| T |
4708165 |
ga |
4708164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 68 - 183
Target Start/End: Complemental strand, 4745984 - 4745869
Alignment:
| Q |
68 |
tttgcagatagtcgttgacgccctaattgatcctaaagtggttataagatatgacccaaagtcactggttagagatcttgctgacctaatagagagatac |
167 |
Q |
| |
|
|||||||||||| |||||| ||||| ||||||||||||||| ||||| |||||| |||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
4745984 |
tttgcagatagttgttgactccctacttgatcctaaagtgggtataatatatgatccaaagtcactgattagagctcttgctgacctaatagagagatac |
4745885 |
T |
 |
| Q |
168 |
acgaagtcgcaggtta |
183 |
Q |
| |
|
| |||||||| |||| |
|
|
| T |
4745884 |
ataaagtcgcatgtta |
4745869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University