View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_1D_low_32 (Length: 206)
Name: NF0342_1D_low_32
Description: NF0342_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_1D_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 49923087 - 49923278
Alignment:
| Q |
1 |
agtccatcatggaactctgttagtccaaactactcacaacccatttctttaattcaatgatttattacaattcaatcatcaatttcacttctttttgcat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49923087 |
agtccatcatggaactctgttagtccaaactactcacaacccatttctttaattcaatgatttattacaattcaatcatcaatttcatttctttttgcat |
49923186 |
T |
|
| Q |
101 |
tttacgaatctgggtcaggttgttctactcgtggga-ttttttacttacttggccattgttggatccattctccctgaaaaacttgttcctg |
191 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
49923187 |
tttacgaatctgggtcaggttgttttactcgtgggatttttttacttacttggccattgttggatccattctccctggaaaacttgttcctg |
49923278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 3 - 191
Target Start/End: Complemental strand, 26777985 - 26777797
Alignment:
| Q |
3 |
tccatcatggaactctgttagtccaaactactcacaacccatttctttaattcaatgatttattacaattcaatcatcaatttcacttctttttgcattt |
102 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||| |||||||||||| ||||||| |||||| |||||||||||| ||||||||||||| |
|
|
| T |
26777985 |
tccatcatggaactccgttagttcaaactactcacaacccattactttaattcaatcatttattccaattctgtcatcaatttcatatctttttgcattt |
26777886 |
T |
|
| Q |
103 |
tacgaatctgggtcaggttgttctactcgtgggattttttacttacttggccattgttggatccattctccctgaaaaacttgttcctg |
191 |
Q |
| |
|
| |||||||||||||||||| | |||| | ||| |||||||||||||| ||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
26777885 |
ttcgaatctgggtcaggttgctttacttgcgggtttttttacttacttagccattgttggatccattctccctggaaagcttgttcctg |
26777797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2017 times since January 2019
Visitors: 2881