View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_2D_high_12 (Length: 369)
Name: NF0342_2D_high_12
Description: NF0342_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_2D_high_12 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 300; Significance: 1e-168; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 2 - 369
Target Start/End: Original strand, 43712615 - 43712980
Alignment:
| Q |
2 |
aattcaacaatcataacaccaaagtaaaaaacagaacttaattagagggtcctacttacaagttcttgaatttgtatttaactagtagtaattgatgcat |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43712615 |
aattcaacaatcataacaccaaagtaaaaaacagaacttaattagagggtcctacttacaagttcttgaatttgtatttaactagtagcaattgatgcat |
43712714 |
T |
 |
| Q |
102 |
aaacaaaaagtctcttcctagggtaagggtactactattactactaagatcgtccaacactgatgtgatggcattttaggattcgaccccactacagcaa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43712715 |
aaacaaaaagtctcttcctagggtaagggtactactattactactaagatcgtcccacactgatgtgatggcattttaggattcgaccccactacagcaa |
43712814 |
T |
 |
| Q |
202 |
tgctacctgagcaaattataacctgctgttgcatcaaattttccctttcatctggctttcatcattcatgataaaatggtacattttcnnnnnnnnnnnn |
301 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43712815 |
tgctacctaagcaaattataacctgctgttgcatcaaattttccctttcccttggctttcatcattcatgataaaatggtacattttc--agagagagaa |
43712912 |
T |
 |
| Q |
302 |
naaattaaagttaattttgatattttggaccctttcttttctcttttatcaattcacctttcatttat |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43712913 |
aaaattaaagttaattttgatattttggaccctttcttttctcttttatcaattcacctttcatttat |
43712980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University