View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0342_2D_high_15 (Length: 342)

Name: NF0342_2D_high_15
Description: NF0342_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0342_2D_high_15
NF0342_2D_high_15
[»] chr2 (1 HSPs)
chr2 (18-323)||(154498-154803)


Alignment Details
Target: chr2 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 18 - 323
Target Start/End: Complemental strand, 154803 - 154498
Alignment:
18 tatatcgccacgaagaaaattatgagacttgatagctgaaatccggtgttagcagaggcggagccatcattgaataggctgcggatggcatcgtcgttgg 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
154803 tatatcgccacgaagaaaattatgagacttgatagctgaaatccggtgttagcagaggcggagccatcattgaataggctgcggatggcatcgtcgttgg 154704  T
118 tagtgaaaaatagagagctgagatcattgtagtggtttggtggacactgaaaattgtcgtagtgtattgagaagcctccggttggggagctgggacactc 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
154703 tagtgaaaaatagagagctgagatcattgtagtggtttggtggacactgaaaattgtcgtagtgtattgagaagcctccggttggggagctgggacactc 154604  T
218 ccctggacatggcacacactttgatagcaatggaagcccaaatcgaatacaggaggttacaaacgagataatcatcaccagtagaatcttgaatattgga 317  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
154603 ccctggacatggcacacactttgatagcaatggaagcccaaatcgaatacaggaggttacaaacgagataatcatcaccagcagaatcttgaatattgga 154504  T
318 cctctc 323  Q
    ||||||    
154503 cctctc 154498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University