View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_2D_high_24 (Length: 301)
Name: NF0342_2D_high_24
Description: NF0342_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_2D_high_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 5e-96; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 101 - 282
Target Start/End: Complemental strand, 26461262 - 26461081
Alignment:
| Q |
101 |
aggttgtgaaagagagtgagaaatggggaattgtcaaacaatagatgctgcagcactagtgatccaacaccctagtgggaagattgagagattgtattgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26461262 |
aggttgtgaaagagagtgagaaatggggaattgtcaaacaatagatgctgcagcactagtgatccaacaccctagtgggaagattgagagattgtattgg |
26461163 |
T |
|
| Q |
201 |
tcagtgagtgcaagttatgtcatgagagccaatcctggttattatgtgtcactcatcatgccattgcctcaagaacaagaag |
282 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26461162 |
tcagtgagtgcaagttatgtcatgagagcaaatcctggttattatgtgtcactcatcatgccattgcctcaagaacaagaag |
26461081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 26461298 - 26461401
Alignment:
| Q |
1 |
gtatattagcatcccatagggtcttcctttttaagaagggctactcaactaacttatggttgttatgaaagtcaatttaaagccaagtttacatcaatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26461298 |
gtatattagcatcccatagggtcttcctttttaagaagggctactcaactaacttatggttgttatgaaagtcaatttaaagccaagtttacatcaatat |
26461397 |
T |
|
| Q |
101 |
aggt |
104 |
Q |
| |
|
|||| |
|
|
| T |
26461398 |
aggt |
26461401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 123 - 270
Target Start/End: Complemental strand, 15407146 - 15406999
Alignment:
| Q |
123 |
atggggaattgtcaaacaatagatgctgcagcactagtgatccaacaccctagtgggaagattgagagattgtattggtcagtgagtgcaagttatgtca |
222 |
Q |
| |
|
||||| ||||||||| | | |||||||||| || ||||||||||| || |||||||||| || |||||||||||| |||| | ||| ||| | || | |
|
|
| T |
15407146 |
atgggaaattgtcaagctgttgatgctgcagttcttgtgatccaacatccatgtgggaagatagatagattgtattggccagtaactgctagtgaagtta |
15407047 |
T |
|
| Q |
223 |
tgagagccaatcctggttattatgtgtcactcatcatgccattgcctc |
270 |
Q |
| |
|
||| | ||||||||||| | ||||| ||| | || |||||||| |||| |
|
|
| T |
15407046 |
tgaaaaccaatcctggtcactatgtttcattgattatgccattacctc |
15406999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University