View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_2D_high_33 (Length: 219)
Name: NF0342_2D_high_33
Description: NF0342_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0342_2D_high_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 21921873 - 21922073
Alignment:
Q |
1 |
tagatttaaagattaacttattttgttgattgcaggattggcacaagggtcacgtccaaaattccggtgcgtagcacaatgcacgaatccaccatcatat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
21921873 |
tagatttaaagattaacttattttgttgattgaaggattggcacaagggtcacgtccaaaattccagtgcgtagcacaatgcacgaatccaccatcatat |
21921972 |
T |
 |
Q |
101 |
tgcaatcagctttgtaaaatcaagggatatggattaggtggtgaatgtatgtttaaaggacctctaaatcaatgttgttgtgttcctaatccccctaaat |
200 |
Q |
|
|
|||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21921973 |
tgcagtcagctttgtaaaaccaagggatatggattaggtggtgaatgtatgtttaaaggacctctaaatcaatgttgttgtgttcctaatccccctaaat |
21922072 |
T |
 |
Q |
201 |
t |
201 |
Q |
|
|
| |
|
|
T |
21922073 |
t |
21922073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University