View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0342_2D_low_21 (Length: 486)
Name: NF0342_2D_low_21
Description: NF0342_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0342_2D_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 369; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 369; E-Value: 0
Query Start/End: Original strand, 88 - 468
Target Start/End: Original strand, 3119011 - 3119391
Alignment:
| Q |
88 |
gattcgtaacgtgaattgaatgtttttctctttcttccattttccatcatactatttctaacaccaaacccataaatctttcttctccaaaaatggcagc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3119011 |
gattcgtaacgtgaattgaatgtttttctctttcttccattttccatcttactatttctaacaccaaacccataaatctttcttctccaaaaatggcagc |
3119110 |
T |
 |
| Q |
188 |
ttgtgtatacaccgtttcacagaacggaaccggcgattttcaaacggtgcaagaagcaattgacgccgtacccctcggtaactctcgccggactgtcatc |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3119111 |
ttgtgtatacaccgtttcacagaacggaaccggcgattttcaaacggtgcaagaagcaattgacgccgtacccctcggcaactctcgccggactgtcatc |
3119210 |
T |
 |
| Q |
288 |
cgggtgtctcctggaatctataagcagcctgtgtatgttcctaaaacgaagaatttcatcactcttgctgggttgtgtcgtgaggagactgtgcttactt |
387 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3119211 |
cgggtgtctcctggaatctataagcagccggtgtatgttcctaaaacgaagaatttcatcactcttgctgggttgtgtcgtgaggagactgtgcttactt |
3119310 |
T |
 |
| Q |
388 |
ggaataacacctctgctaagattgatcatcatcaagtatgtgctcgttttctttgtgttttgttcattttgggtaatgggt |
468 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3119311 |
ggaataacacctctgctaagattgatcatcatcaagtatgtgctcgttttctttgtgttttgttcattttgggtaatgggt |
3119391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University